| DETAILS: | Health, (Edit) |
|---|---|
| Address: | 1, 167 Logan Rd, Woolloongabba QLD 4102, Australia |
| Postal code: | 4102 |
| Phone: | (07) 3339 5102 |
| Website: | http://mlea.com.au/ |
| Opening hours (Edit) | |
|---|---|
| Monday: | 9:00 AM – 5:00 PM |
| Tuesday: | 9:00 AM – 5:00 PM |
| Wednesday: | 9:00 AM – 5:00 PM |
| Thursday: | 9:00 AM – 5:00 PM |
| Friday: | 9:00 AM – 5:00 PM |
| Saturday: | Closed |
| Sunday: | Closed |
At MLEA, our core business is providing expert opinion to support the fair resolution of personal injury compensation claims - it's something we've excelled at for almost 30 years. MLEA is known for the quality, reliability and objectivity of our reports and assessments.
https://mlea.com.au/reception@mlea.com.au. www.mlea.com.au.
https://mlea.com.au/contact/Phone 07 3339 5102. Make a booking. Flexibility and expertise. At MLEA, we've excelled at expert medicolegal opinions for almost 30 years. Additionally, our specialist clinicians work with employers to provide pre-employment evaluations and workplace assessments and plans.
https://mlea.com.au/services/Phone 07 3339 5102. Make a booking. The mlea story. MLEA (Medicolegal Experts Australia) was founded in 2011 by respected Occupational Therapist, Vanessa Aitken.
https://mlea.com.au/about/Phone 07 3339 5102. Make a booking. Building a safe, productive workplace. MLEA employment services are a great way to invest in the health and safety of your biggest asset - your people.
https://mlea.com.au/services/workplace/NOTE: MLEA Tuition fees will cover the course instruction and lunch if the course is a full day or more in length. For MLEA Professional Program course questions, registration, or to schedule a course on the MLEA 06febAll Day07INVESTIGATING SEXUAL ASSAULT Event Organized By: Kayla Bragg.
https://dojmt.gov/mlea/professional-programs-schedule/View and Download York MLCA-MLHA-07-24 installation & owner's manual online. MINISPLIT HIGH WALL air conditioner. TECHNICAL SPECIFICATION Technical Specifications : Master Gold ''R22'' - 60 Hz Indoor Models Unit MLEA07 MLKA07 MLEA09...
https://www.manualslib.com/manual/487871/York-Mlca-Mlha-07-24.html?page=19Последние твиты от Proyecto Juventud (@MLEA_PJ). Proyecto Juventud is @Mujereslatinas youth program. Serving teens ages 12-18 years old we aim to cultivate the next generation of Latin@ young leaders.
https://twitter.com/MLEA_PJBKK23550 ([gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATTCAGTGATCCTCCC, downstream forward: _UP4_TAAATGTAGCTAAACAGCAC.
http://subtiwiki.uni-goettingen.de/v3/gene/view/160EBB7885D7C7FD30A6E35605A862C156E2DA80Mlea Tnä is on Facebook. Join Facebook to connect with Mlea Tnä and others you may know. Facebook gives people the power to share and makes the world...
https://www.facebook.com/lestina.mlea.7The phone number for MLEA is (07) 3339 5102.
MLEA is located at 1, 167 Logan Rd, Woolloongabba QLD 4102, Australia
The website (URL) for MLEA is: http://mlea.com.au/
MLEA is open:
Monday:9:00 AM – 5:00 PM
Tuesday:9:00 AM – 5:00 PM
Wednesday:9:00 AM – 5:00 PM
Thursday:9:00 AM – 5:00 PM
Friday:9:00 AM – 5:00 PM
Saturday:Closed
Sunday:Closed